EUTREP7
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0001220 |
---|---|
TE superfamily | ERV1 |
TE class | LTR |
Species | Eutheria |
Length | 392 |
Kimura value | 27.84 |
Tau index | 0.0000 |
Description | Conserved repetitive element present in placental mammals. |
Comment | 4 bp TSDs. Orientation confirmed with appropriately placed AATAAA signal. ERV1 designation is uncertain, as other LTR elements with 4 bp TSDs have been identified. |
Sequence |
TGTAAAAGAAAAATTGTCCCAAACCTGGTCTGGGACAGAACCTTTTTGCGTGATGTAATTCACAACCTCCTTCTGGGAAGAAATTAGCATTCCTGATAAAATGCTTAAGCAATTTTCTGATAAACTTTAATGGGATTAAGACTTGTTCTGGGAAACCAGTCACCCACCCAGCCGACTGTCAGTCAAGAGTCTAGTGACCTTTAACCAGACATTCTTTTCTTTTTGTATCTAGTCTAACAATGATTATCTAACCATTCTCTTTTCCTATAAAATGTCCCTACCAAGAGNGAATCTTTGAATTGGCCTNCTAGAGGCCTTTTCCCTTGCAGCAAGNTTGNAATAAAACTTTGACACGTGCTCATAACTAAATTGTCTGAAAAGTTTCTTTAACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
EUTREP7 | NR4A2 | 195 | 202 | - | 14.20 | AAAGGTCA |
EUTREP7 | PK03576.1 | 352 | 358 | + | 14.20 | CACGTGC |
EUTREP7 | BHLH49 | 352 | 358 | + | 14.16 | CACGTGC |
EUTREP7 | PK06517.1 | 352 | 358 | + | 14.07 | CACGTGC |
EUTREP7 | PK18474.1 | 352 | 358 | + | 14.05 | CACGTGC |
EUTREP7 | DOF4.3 | 377 | 389 | + | 13.98 | AAAAGTTTCTTTA |
EUTREP7 | HHO5 | 289 | 296 | - | 13.94 | AAAGATTC |
EUTREP7 | Npas2 | 351 | 358 | - | 13.93 | GCACGTGT |
EUTREP7 | PK24205.1 | 350 | 357 | - | 13.92 | CACGTGTC |
EUTREP7 | JUN | 50 | 59 | + | 13.90 | GTGATGTAAT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.