Charlie15a
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000089 |
---|---|
TE superfamily | Charlie |
TE class | DNA |
Species | Eutheria |
Length | 224 |
Kimura value | 29.28 |
Tau index | 0.7845 |
Description | hAT-Charlie DNA transposon, Charlie15a subfamily (non-autonomous) |
Comment | 8bp Charlie-type TSDs; 16 bp TIRs. |
Sequence |
CAGTGGTTTTCAAACTGTGTTCCGCGGAGCCCTAGGGGTTCCGCGGAGGTGCCTCGGGGGCTGCTGGGNGGGNNGTGAGGCTGGGCGGGCGGGGCTCTGGGCCTCCCACCCCCGCTTCAACCAGAGCAGCTCCGCTTTTATCTGTTTTATATATTGGGCTTCCGCGTAAGATTTCATTTGAAGAAAGGGTTCTGCTGCTTAAAAAAAAAGTTTGAAAACCACTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
Charlie15a | PLAG1 | 26 | 39 | + | 5.42 | GGAGCCCTAGGGGT |
Charlie15a | GLI3 | 99 | 113 | + | 2.88 | GGGCCTCCCACCCCC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.