Arthur1A
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000070 |
|---|---|
| TE superfamily | Tip100 |
| TE class | DNA |
| Species | Eutheria |
| Length | 177 |
| Kimura value | 25.80 |
| Tau index | 0.0000 |
| Description | hAT-Tip100 DNA transposon, Arthur1A subfamily |
| Comment | Arthur1A has 8 bp TSDs and 12 bp TIRs. Positions 1-79 and 79-177 correspond to 1-79 & 3849-3947 of the autonomous Arthur1. |
| Sequence |
CAGAGGCGGATTTACCGTGAAGCTAATGAAGCTTAAGCTTCAGGGCCCCTCACTTGCACGGGCCCCTTCCAAGGCCCTGTACCTAATTTTGTATTCGTAATTTTGTATTCTTTTTCTTAAAGAGGGCCCCCCAAATTGTATAAGCTTCAGGCCCCACAAAACCTGGATCCGCCCCTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Arthur1A | StBRC1 | 124 | 130 | + | 12.69 | GGGCCCC |
| Arthur1A | StBRC1 | 43 | 49 | + | 12.69 | GGGCCCC |
| Arthur1A | StBRC1 | 60 | 66 | + | 12.69 | GGGCCCC |
| Arthur1A | PK19717.1 | 149 | 157 | + | 12.66 | AGGCCCCAC |
| Arthur1A | PK19717.1 | 122 | 130 | - | 12.56 | GGGGCCCTC |
| Arthur1A | PK19717.1 | 43 | 51 | + | 12.56 | GGGCCCCTC |
| Arthur1A | cassava45561.m1 | 149 | 157 | + | 12.49 | AGGCCCCAC |
| Arthur1A | MYB59 | 80 | 87 | - | 12.39 | ATTAGGTA |
| Arthur1A | TFAP4::ETV1 | 160 | 172 | - | 12.35 | GCGGATCCAGGTT |
| Arthur1A | zen | 23 | 29 | + | 12.23 | CTAATGA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
