Arthur1A

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000070
TE superfamily Tip100
TE order DNA
Species Eutheria
Length 177
Kimura value 25.80
Tau index 0.0000
Description hAT-Tip100 DNA transposon, Arthur1A subfamily
Comment Arthur1A has 8 bp TSDs and 12 bp TIRs. Positions 1-79 and 79-177 correspond to 1-79 & 3849-3947 of the autonomous Arthur1.
Sequence
CAGAGGCGGATTTACCGTGAAGCTAATGAAGCTTAAGCTTCAGGGCCCCTCACTTGCACGGGCCCCTTCCAAGGCCCTGTACCTAATTTTGTATTCGTAATTTTGTATTCTTTTTCTTAAAGAGGGCCCCCCAAATTGTATAAGCTTCAGGCCCCACAAAACCTGGATCCGCCCCTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Arthur1A StBRC1 124 130 + 12.69 GGGCCCC
Arthur1A StBRC1 43 49 + 12.69 GGGCCCC
Arthur1A StBRC1 60 66 + 12.69 GGGCCCC
Arthur1A PK19717.1 149 157 + 12.66 AGGCCCCAC
Arthur1A PK19717.1 122 130 - 12.56 GGGGCCCTC
Arthur1A PK19717.1 43 51 + 12.56 GGGCCCCTC
Arthur1A cassava45561.m1 149 157 + 12.49 AGGCCCCAC
Arthur1A MYB59 80 87 - 12.39 ATTAGGTA
Arthur1A TFAP4::ETV1 160 172 - 12.35 GCGGATCCAGGTT
Arthur1A zen 23 29 + 12.23 CTAATGA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).