Arthur1A

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000070
TE superfamily Tip100
TE order DNA
Species Eutheria
Length 177
Kimura value 25.80
Tau index 0.0000
Description hAT-Tip100 DNA transposon, Arthur1A subfamily
Comment Arthur1A has 8 bp TSDs and 12 bp TIRs. Positions 1-79 and 79-177 correspond to 1-79 & 3849-3947 of the autonomous Arthur1.
Sequence
CAGAGGCGGATTTACCGTGAAGCTAATGAAGCTTAAGCTTCAGGGCCCCTCACTTGCACGGGCCCCTTCCAAGGCCCTGTACCTAATTTTGTATTCGTAATTTTGTATTCTTTTTCTTAAAGAGGGCCCCCCAAATTGTATAAGCTTCAGGCCCCACAAAACCTGGATCCGCCCCTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Arthur1A MYB27 80 91 - 17.77 CAAAATTAGGTA
Arthur1A TB1 124 132 + 17.38 GGGCCCCCC
Arthur1A Prdm15 157 167 + 16.85 CAAAACCTGGA
Arthur1A PLAGL2 124 131 + 15.67 GGGCCCCC
Arthur1A MYB57 80 89 + 15.44 TACCTAATTT
Arthur1A ARALYDRAFT_495258 150 157 + 15.43 GGCCCCAC
Arthur1A ARALYDRAFT_484486 150 157 + 15.43 GGCCCCAC
Arthur1A PK19717.1 124 132 + 15.24 GGGCCCCCC
Arthur1A MYB108 80 89 + 14.75 TACCTAATTT
Arthur1A ARALYDRAFT_493022 150 157 + 14.64 GGCCCCAC


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).