Arthur1A

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000070
TE superfamily Tip100
TE order DNA
Species Eutheria
Length 177
Kimura value 25.80
Tau index 0.0000
Description hAT-Tip100 DNA transposon, Arthur1A subfamily
Comment Arthur1A has 8 bp TSDs and 12 bp TIRs. Positions 1-79 and 79-177 correspond to 1-79 & 3849-3947 of the autonomous Arthur1.
Sequence
CAGAGGCGGATTTACCGTGAAGCTAATGAAGCTTAAGCTTCAGGGCCCCTCACTTGCACGGGCCCCTTCCAAGGCCCTGTACCTAATTTTGTATTCGTAATTTTGTATTCTTTTTCTTAAAGAGGGCCCCCCAAATTGTATAAGCTTCAGGCCCCACAAAACCTGGATCCGCCCCTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Arthur1A PLAGL2 125 132 + 13.18 GGCCCCCC
Arthur1A VIT_15s0048g01150 150 157 + 13.13 GGCCCCAC
Arthur1A sptf-3 169 175 + 13.11 CCGCCCC
Arthur1A TCP23 150 157 + 13.11 GGCCCCAC
Arthur1A MYB62 81 89 - 12.89 AAATTAGGT
Arthur1A MYB39 78 89 + 12.80 TGTACCTAATTT
Arthur1A MYB121 80 88 + 12.79 TACCTAATT
Arthur1A AT3G10580 134 147 + 12.71 AATTGTATAAGCTT
Arthur1A TCP8 150 157 + 12.69 GGCCCCAC
Arthur1A OsI_08196 150 157 + 12.69 GGCCCCAC


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).