Arthur1A
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000070 |
|---|---|
| TE superfamily | Tip100 |
| TE order | DNA |
| Species | Eutheria |
| Length | 177 |
| Kimura value | 25.80 |
| Tau index | 0.0000 |
| Description | hAT-Tip100 DNA transposon, Arthur1A subfamily |
| Comment | Arthur1A has 8 bp TSDs and 12 bp TIRs. Positions 1-79 and 79-177 correspond to 1-79 & 3849-3947 of the autonomous Arthur1. |
| Sequence |
CAGAGGCGGATTTACCGTGAAGCTAATGAAGCTTAAGCTTCAGGGCCCCTCACTTGCACGGGCCCCTTCCAAGGCCCTGTACCTAATTTTGTATTCGTAATTTTGTATTCTTTTTCTTAAAGAGGGCCCCCCAAATTGTATAAGCTTCAGGCCCCACAAAACCTGGATCCGCCCCTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Arthur1A | ZAP1 | 14 | 28 | + | -4.55 | ACCGTGAAGCTAATG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.