Charlie4z

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000026
TE superfamily Charlie
TE order DNA
Species Eutheria
Length 167
Kimura value 29.90
Tau index 0.7613
Description hAT-Charlie DNA transposon, Charlie4z subfamily
Comment 84% ID to MER80B. Not really an internal deletion product, but more like a "Ds" for the Charlie4 "Ac", having almost identical TIRs.
Sequence
CAGGGGTTCTTAACCTGGGGTCCATGGATGGGCTTCAGGGGGTCCGTGAACCCCCTGAAATTGTATGCAAAATTTTGTGCGTATGTGCATTTTTCTGGGGAGAGGGTCCATAGCTTTCATCAGATTCTCAAAGGGGTCCGTGACCCCAAAAAGGTTAAGAACCACTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Charlie4z POU2F3 64 72 + 12.79 TATGCAAAA
Charlie4z HHO6 122 128 + 12.63 AGATTCT
Charlie4z sug 33 44 - 12.56 GACCCCCTGAAG
Charlie4z INSM1 49 60 - 12.50 TTTCAGGGGGTT
Charlie4z TB1 37 45 - 12.46 GGACCCCCT
Charlie4z POU5F1 65 71 + 12.44 ATGCAAA
Charlie4z nub 64 74 + 12.41 TATGCAAAATT
Charlie4z RARB 134 146 + 12.33 GGGTCCGTGACCC
Charlie4z rib 66 74 + 12.31 TGCAAAATT
Charlie4z Stat5a::Stat5b 93 101 - 12.18 TCCCCAGAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).