Charlie4z

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000026
TE superfamily Charlie
TE order DNA
Species Eutheria
Length 167
Kimura value 29.90
Tau index 0.7613
Description hAT-Charlie DNA transposon, Charlie4z subfamily
Comment 84% ID to MER80B. Not really an internal deletion product, but more like a "Ds" for the Charlie4 "Ac", having almost identical TIRs.
Sequence
CAGGGGTTCTTAACCTGGGGTCCATGGATGGGCTTCAGGGGGTCCGTGAACCCCCTGAAATTGTATGCAAAATTTTGTGCGTATGTGCATTTTTCTGGGGAGAGGGTCCATAGCTTTCATCAGATTCTCAAAGGGGTCCGTGACCCCAAAAAGGTTAAGAACCACTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Charlie4z RXRG 134 147 - 13.60 GGGGTCACGGACCC
Charlie4z SEP3 145 154 - 13.55 CCTTTTTGGG
Charlie4z NR2F6 133 147 + 13.40 GGGGTCCGTGACCCC
Charlie4z REI1 35 41 - 13.40 CCCCTGA
Charlie4z REI1 52 58 + 13.40 CCCCTGA
Charlie4z NR1H4::RXRA 134 146 - 13.27 GGGTCACGGACCC
Charlie4z THRB 141 157 + 13.09 TGACCCCAAAAAGGTTA
Charlie4z ESR2 132 146 - 13.06 GGGTCACGGACCCCT
Charlie4z THRB 141 157 - 12.91 TAACCTTTTTGGGGTCA
Charlie4z AP3 145 157 + 12.89 CCCAAAAAGGTTA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).