Charlie10b
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000083 |
|---|---|
| TE superfamily | Charlie |
| TE order | DNA |
| Species | Eutheria |
| Length | 242 |
| Kimura value | 22.60 |
| Tau index | 0.0000 |
| Description | hAT-Charlie DNA transposon, Charlie10b subfamily (non-autonomous) |
| Comment | - |
| Sequence |
CAGTGCTACTCAAAGTGCCGGTCCGCGACGAGATAAGGAGCTTGCGCCAGAATGTAAATCAACGCACTGCTTCCTTCATCGAGAAAGTCTTGCTACGAAAAAAATGTCAGCTGAACTAAACAGTGTGCTTAGTGACGTAGTTGATTTACATTCTGGCGCAAGCTCCTTATCTCGTCGCGGACCGGTAACAAACAGTTCGCGGACCGGCAGCCGGTCCGCGGACCACACTTTGAGTAGCACTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Charlie10b | TCP4 | 219 | 226 | + | 6.40 | CGGACCAC |
| Charlie10b | PAX9 | 173 | 188 | + | -0.80 | CGTCGCGGACCGGTAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
