Charlie10a
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000082 |
|---|---|
| TE superfamily | Charlie |
| TE order | DNA |
| Species | Eutheria |
| Length | 280 |
| Kimura value | 23.06 |
| Tau index | 1.0000 |
| Description | hAT-Charlie DNA transposon, Charlie10a subfamily (non-autonomous) |
| Comment | - |
| Sequence |
CAGTGCTACTCAAAGTGTGGCCCATGGACCGGTGCCAGTCCGCGAACTGTTTGTTACCGGTCCGCGACGAGATAAGGAGCTTGCGCCAGAATGTAAATCAACGCACTGCTTCCTTCATCGAGAAAGTCTTGCTACGAAAAAAATGTCAGCTGAACTAAACAGTGTGCTTAGTGACGTAGTTGATTTACATTCTGGCGCAAGCTCCTTATCTCGTCGCGGACCGGTAACAAACAGTTCGCGGACCGGCACTGGTCCGCGGACCACACTTTGAGTAGCACTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Charlie10a | PAX9 | 212 | 227 | + | -0.80 | CGTCGCGGACCGGTAA |
| Charlie10a | PAX9 | 54 | 69 | - | -0.80 | CGTCGCGGACCGGTAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.